mageck-ibar is the analysis software for CRISPR/Cas9 with iBAR system applied library screening.
The software is developed for Linux system using Python 3 language.
The software takes great advantages of following Python packages.
For the operation system, Linux are the applying platform. And any of the major maintaining distribution is sufficient, centos, fedora, debian, ubuntu for instance.
- Python (require version > 3.x)
- Pandas (require version > 0.18) is an open source data structures and data analysis tools for Python.
- NumPy (require version > 1.10) is the fundamental Python package for scientific computing.
- SciPy (require version > 0.17) is the python ecosystem for mathematics, science, and engineering. Pandas and NumPy are also the core packages of SciPy.
- RRA in MAGeCk is integrated in the ibar software.
- Download the souce code.
- enter the directory.
python3 setup.py installor local install withpython3 setup.py install --user
usage: mageck-ibar [-h] -i INPUT [-b] [-n] [--col-gene COL_GENE]
[--col-guide COL_GUIDE] [--col-barcode COL_BARCODE]
-c COL_CONTROL [COL_CONTROL ...] -t COL_TREAT [COL_TREAT ...]
[-o OUTPREFIX] [--largerthan LARGERTHAN] [--test {norm}]
[--gene-test-fdr-threshold GENE_TEST_FDR_THRESHOLD]
[--RRApath RRAPATH] [-p {DEBUG,INFO,WARNING,ERROR}]
Analysis CRISPR/Cas9 screening data, capable of analysis data with or without
barcode integrated.
optional arguments:
-h, --help show this help message and exit
-i INPUT, --input INPUT Count table, should include <gene> <guide> <barcode> <control> <treatment>.
-b, --with-barcode Whether the data contain barcode.
-n, --two-rra Using two cycles RRA for barcode analysis.
--col-gene COL_GENE The column name of gene column in input file.
--col-guide COL_GUIDE The column name of guide column in input file.
--col-barcode COL_BARCODE The column name of barcode column in input file.
-c COL_CONTROL [COL_CONTROL ...], --col-control COL_CONTROL [COL_CONTROL ...] The column name of control column in input file.
-t COL_TREAT [COL_TREAT ...], --col-treat COL_TREAT [COL_TREAT ...] The column name of treatment column in input file.
-o OUTPREFIX, --outprefix OUTPREFIX Output file prefix.
--largerthan LARGERTHAN Normalized count should be larger than the threshold gaven, default is 10.
--test {norm} The test method used in analysis.
--gene-test-fdr-threshold GENE_TEST_FDR_THRESHOLD p value threshold for alpha value of RRA in gene test (RRA -p)
--RRApath RRAPATH The Robust Rank Aggregation program path.
-p {DEBUG,INFO,WARNING,ERROR}, --print-level {DEBUG,INFO,WARNING,ERROR} The information print level of the running program.
For typical library screening data, the run time can be 5 minutes (1E6 barcodes with two replicates) or more, depending on the data size.
Sample data is provied in the ./sample directory.
161124 row data with two reference and two experiment data columns.
gene,guide,barcode,D0R1,D0R2,PSR1,PSR2
EMP1,AAAAAAAAGAGCCAACATGT,ATGCCA,205,225,6,6
EMP1,AAAAAAAAGAGCCAACATGT,CTAGTA,166,138,7,3
EMP1,AAAAAAAAGAGCCAACATGT,GTCGCG,32,20,1,0
EMP1,AAAAAAAAGAGCCAACATGT,TTCTTC,42,64,2,5
Under linux ternimal:
mageck-ibar -i sample.csv -c D0R1 D0R2 -t PSR1 PSR2 -o ./sample_result
File contains the sgRNA or barcode information.
Analysis file for the up regulated sgRNAs.
Analysis file for the down regulated sgRNAs.
Result of ibar analysis for the enriched genes.
group_id, items_in_group, lo_value, p, FDR, goodsgrna
HPRT1, 12, 3.1175e-45, 2.5936e-07, 0.000134, 12
ITGB1, 8, 4.8659e-17, 2.5936e-07, 0.000134, 8
SRGAP2, 7, 5.8243e-15, 2.5936e-07, 0.000134, 7
Result of ibar analysis for the drop-out genes.
group_id, items_in_group, lo_value, p, FDR, goodsgrna
THAP11, 10, 1.5596e-08, 5.1873e-07, 0.004455, 10
MAK16, 12, 4.4624e-08, 1.5562e-06, 0.004455, 12
CPSF6, 7, 4.6853e-08, 1.8156e-06, 0.004455, 7
Released under GNU General Public License v3
Author: Zhiheng Liu [email protected] Version: 0.1.1